View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_high_58 (Length: 260)
Name: NF0599_high_58
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_high_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 56133323 - 56133163
Alignment:
| Q |
1 |
aattatataataacaactactatgaataattattgatattgttaataatggtatgaatctagctaaggaattagtaaaaa---gaaacatggatggaagt |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56133323 |
aattatatgataacaactactatgaataattattgatattgttaataatggtatgaatctagctaaggaattagtaaaaattagaaacatggatggaagt |
56133224 |
T |
|
| Q |
98 |
ttgattgaataaaagaccagacagacatgacctcgagattttgaagacatggagagcgtag |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56133223 |
ttgattgaataaaagaccagacagacatgacctcgagattttgaagacatggagagcgtag |
56133163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 570 times since January 2019
Visitors: 3835