View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_high_61 (Length: 255)

Name: NF0599_high_61
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_high_61
NF0599_high_61
[»] chr8 (2 HSPs)
chr8 (128-255)||(43751285-43751412)
chr8 (26-72)||(43751190-43751236)
[»] chr1 (1 HSPs)
chr1 (172-253)||(49164885-49164966)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 128 - 255
Target Start/End: Original strand, 43751285 - 43751412
Alignment:
128 caagttgatatacatcttaattatttactagtatatcccagtagattttgaacaaaagtatttgaaggaaaaacaaagcgttatcgtccttcaagtcttg 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
43751285 caagttgatatacatcttaattatttactagtatatcccagtagattttgaacaaaagtatatgaaggaaaaacaaagcgttatcgtccttcaagtcttg 43751384  T
228 gataatgggagaacttggaatgttaagc 255  Q
    ||||||||||||||||||||||||||||    
43751385 gataatgggagaacttggaatgttaagc 43751412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 26 - 72
Target Start/End: Original strand, 43751190 - 43751236
Alignment:
26 catattcctatgctaataaatacatggtgagtctttcaatagcttca 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
43751190 catattcctatgctaataaatacatggtgagtctttcaatagcttca 43751236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 253
Target Start/End: Original strand, 49164885 - 49164966
Alignment:
172 attttgaacaaaagtatttgaaggaaaaacaaagcgttatcgtccttcaagtcttggataatgggagaacttggaatgttaa 253  Q
    |||||||||||||||||||||||||| | |||||||  |||| |||||| ||||||||| ||| |||||| |||| ||||||    
49164885 attttgaacaaaagtatttgaaggaacagcaaagcgaaatcgcccttcaggtcttggatgatgagagaacatggattgttaa 49164966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 168 times since January 2019
Visitors: 3831