View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_high_67 (Length: 248)
Name: NF0599_high_67
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 8436730 - 8436953
Alignment:
Q |
1 |
taaactacaaaaatgtaggcccatgcatcttgatgaagatttcatggtggcacttgcgaaaattaaggataaagtcaattgtaacaaagtgtttggtacg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
8436730 |
taaactacaaaaatgtaggcccatgcatcttgatgaagatttcatggtggcacttgcgaaaattgaggataaagtcaattgtaacaaagtgtttggtacg |
8436829 |
T |
 |
Q |
101 |
tataagaacagtgagattataattggagcagaagtggaattcaatggttatgcttgtgcagtaataaaaggtgagaatgggaatcattggtgcgtgcaat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
8436830 |
tataagaacagtgagattataattggagcagaagttgaattcaat-gttatgcttgtgcagtaataaaaggtgagaatgggaatcattggtgcgtgccat |
8436928 |
T |
 |
Q |
201 |
taataagcttgttctttacaagttt |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
8436929 |
taataagcttgttctttacaagttt |
8436953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University