View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_high_69 (Length: 236)
Name: NF0599_high_69
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_high_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 38625819 - 38625704
Alignment:
| Q |
1 |
ttgatgattaacatatgatgacgctgctcttgttagtaaatgagctacatttttggattaactccgaatgtaacttatcctttggatctgctgcagttgg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625819 |
ttgatgattaacatatgataacgctgctcttgttagtaaatgagctacatttttggattaactccgaatgtaacttatcctttggatctgctgcagttgg |
38625720 |
T |
|
| Q |
101 |
tatgttgtcctttcct |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38625719 |
tatgttgtcctttcct |
38625704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 927 times since January 2019
Visitors: 3837