View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_high_71 (Length: 231)
Name: NF0599_high_71
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_high_71 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 8436383 - 8436607
Alignment:
Q |
7 |
acgttgtctgaaacatgcattataaaagtccatcgagaacatcactcaaatagttatatgaagcaatgacactttaatatggaagcgtaacaattcttaa |
106 |
Q |
|
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
T |
8436383 |
acgttgtctgaaacatgcatgataaaagtccattgagaacatcactcaaatagttatatgaagcaatggcactttaatacggaagcgtaacaattcttaa |
8436482 |
T |
 |
Q |
107 |
agtttttgtatcacttttgtcagttgtcgaatttccgtatagcaaactgtataaatcttcaattcgaatacatactgatgcctcataattcatataggtt |
206 |
Q |
|
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
8436483 |
agtttttgtatcacttttgtgagctgtcgaatttccgtatagcaaactgtataaatcttcatttcgaatacatactgatgcctcataattcatataggtt |
8436582 |
T |
 |
Q |
207 |
cttttagggcatgaatttttattgt |
231 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
8436583 |
cttttagggcatgaatttttattgt |
8436607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University