View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_high_73 (Length: 224)
Name: NF0599_high_73
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_high_73 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 5115318 - 5115170
Alignment:
Q |
1 |
tataatgtattgttgttatcagcttgattctatatgaggcatatccgagttgacagaaaatgagacttaaatgctctattgtttctatttggactcacat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5115318 |
tataatgtattgttgttatcagcttgattctatatgaggcatatccgagttgacagaaaatgagacttaaatgctctattgtttctatttggactcacat |
5115219 |
T |
 |
Q |
101 |
aagtattaagaaaagtataaaacaatgcagccatattttgatacctttg |
149 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5115218 |
aagtattaagaaaagtataaaacaatgcagccatattttgatacctttg |
5115170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2981 times since January 2019
Visitors: 3831