View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_high_75 (Length: 201)

Name: NF0599_high_75
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_high_75
NF0599_high_75
[»] chr2 (1 HSPs)
chr2 (1-84)||(38625736-38625819)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 38625819 - 38625736
Alignment:
1 ttgatgattaacatatgatgacgctgctcttgttagtaaatgagctacatttttggattaactccgaatgtaacttatcctttg 84  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38625819 ttgatgattaacatatgataacgctgctcttgttagtaaatgagctacatttttggattaactccgaatgtaacttatcctttg 38625736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1432 times since January 2019
Visitors: 3846