View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_21 (Length: 437)
Name: NF0599_low_21
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 135 - 342
Target Start/End: Complemental strand, 36041726 - 36041523
Alignment:
| Q |
135 |
gattcaatcaattttaatttataattctaaaattacctagattaactcacgacagtccgatcttgattgaaagaccactaatattaat------gtataa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36041726 |
gattcaatcaattttaatttataattctaaa----------ttaactcacgacagtccgatcttgattgaaagaccactaatattaatattaatgtataa |
36041637 |
T |
|
| Q |
229 |
ctatatgactatagggattctttgattacagcaaatttttgtctatgttttaatgtttgtatacgtacgtacgtacgtacatgcatatcagtttatcacg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||| |
|
|
| T |
36041636 |
ctatatgactatagggattctttgattacagcaaatttttgtctatgttttaatgtttgtatacgtacgtacgtacatgcatatatatcagtttatcacg |
36041537 |
T |
|
| Q |
329 |
ggcctctgattctt |
342 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36041536 |
ggcctctgattctt |
36041523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 15 - 139
Target Start/End: Complemental strand, 36041900 - 36041777
Alignment:
| Q |
15 |
aacctgtgggaagccagggagagagtatcaattgtctcaatcacaattcacaaatagtatttacgtgacttaactgtgagagagtcaagtccaatatagt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
36041900 |
aaccagtgggaagccagggagagagtatcaattgtctcaatcacaattcacaaatagtatttacgtgac-taactgtgagagagtcaaatccaatatagt |
36041802 |
T |
|
| Q |
115 |
atgtgtgttttaagaagttggattc |
139 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36041801 |
atgtgtgttttaagaagttggattc |
36041777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 724 times since January 2019
Visitors: 3837