View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_30 (Length: 381)
Name: NF0599_low_30
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 29 - 375
Target Start/End: Complemental strand, 37835702 - 37835356
Alignment:
Q |
29 |
aacaacttagagaaacaacacttcagaagcatgggaaattgtaagttacacataataatacaatacgatcgatataatcaaagcaatttataattataat |
128 |
Q |
|
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
37835702 |
aacaacttagagaaacaacaattcagaagtatgggaaattgtaagttacacataataatacaatacgatcgatataatcaaagcaatttataattttaat |
37835603 |
T |
 |
Q |
129 |
cataatgatcaaatataattagttgtataaaattaatttgattttaatttttgttgggggtggcactggcaggagtataatgaatgtgcctttggatgaa |
228 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37835602 |
cataatgattaaatataattagttgtataaaattaatttgattttaatttttgttgggggtggcactggcaggagtataatgaatgtgcctttggatgaa |
37835503 |
T |
 |
Q |
229 |
gcacaattcatatctatgcttcttaaaattatgaatgctnnnnnnncattagaaattggagtcttcactggttattctcttcttgctacagctcttgctc |
328 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37835502 |
gcacaattcatatctatgcttcttaaaattatgaatgctaaaaaaacattagaaattggagtcttcactggttattctcttcttgctacagctcttgctc |
37835403 |
T |
 |
Q |
329 |
ttccttttgacggcaaggtatcattttagtgtaaatcttacatttga |
375 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37835402 |
ttccttttgacggcaaggtatcattttagtgtaaatcttacatttga |
37835356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 348
Target Start/End: Original strand, 39054787 - 39054855
Alignment:
Q |
280 |
gaaattggagtcttcactggttattctcttcttgctacagctcttgctcttccttttgacggcaaggta |
348 |
Q |
|
|
|||||||| |||| ||||||||| |||||||| | || |||||||||||||||| ||| || |||||| |
|
|
T |
39054787 |
gaaattggtgtctacactggttactctcttctctccactgctcttgctcttccttctgatggaaaggta |
39054855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 981 times since January 2019
Visitors: 3838