View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_32 (Length: 370)
Name: NF0599_low_32
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 40749801 - 40750079
Alignment:
Q |
1 |
tatttatgatgatggtgacgcacacggtgtgtttaatgtaactttgtaagccaaagaaaacccaacaccctacgacacagcatcctatgcacacccatgc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
40749801 |
tatttatgatgatggtgacgcacacggtgtgtttaatgtaactttgtaagccaaagaaaacccaacaccctacgacacagcatcctatgcaca-ccatgc |
40749899 |
T |
 |
Q |
101 |
cgatgagaccgtaa------cataacagtgacaagtaacaccaacattcaaaaagctgtcnnnnnnnncaggcga----gtagtttagtgactaaaactt |
190 |
Q |
|
|
|||||||||||||| |||||| |||||||||||||||||||| |||||||||||| ||| || ||||||||||||||||||||| |
|
|
T |
40749900 |
cgatgagaccgtaacataaccataaccgtgacaagtaacaccaacatccaaaaagctgtc-tttttttcagttgatccggtagtttagtgactaaaactt |
40749998 |
T |
 |
Q |
191 |
cacattttttaagatgaaaagataggttgtctaagcttcgaatctcaatctctacatatattactctacaaatcacctgac |
271 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
40749999 |
cacattttttaaaatgaaaagataggttgtctaagctttgaatttcaatctctacatatattactctacaaatcacctgac |
40750079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University