View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_34 (Length: 363)
Name: NF0599_low_34
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 16 - 325
Target Start/End: Original strand, 43475730 - 43476038
Alignment:
| Q |
16 |
ggagcagagaatggagatgacctttgttctcatgggagagggatcaatttcttgagctagaggtttttattgtagagtgcagatttttcgaacaaatggg |
115 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43475730 |
ggagctgagaatggagatggcctttgttctcatggg-gagggatcaatttcttgagctagaggtttttattgtagagtgcagatttttcggacaaatggg |
43475828 |
T |
|
| Q |
116 |
tttggactttggagacacgattctatggttgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgtttctgcagaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43475829 |
tttggactttggagacacgattctatggttgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgtttctgcagaat |
43475928 |
T |
|
| Q |
216 |
tgttgagagctttcaaagtttttgtggagcgatttggttccattgaaattcacggtttttagatggaagagtattgcaggacagaatcatgacgaagggt |
315 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
43475929 |
tgttgagggctttcaaagtttctgtggagcggtttggttccattgaaattcacggtttttagatggaagagtattgcaggacataatcatgacgatgggt |
43476028 |
T |
|
| Q |
316 |
gctctgaaag |
325 |
Q |
| |
|
|||||||||| |
|
|
| T |
43476029 |
gctctgaaag |
43476038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 16 - 325
Target Start/End: Complemental strand, 43564568 - 43564255
Alignment:
| Q |
16 |
ggagcagagaatggagatgacctttgttctcatgggagagggatcaatttcttgagctagaggtttttattgtag-----------agtgcagatttttc |
104 |
Q |
| |
|
||||| |||| | |||||| |||||||| || ||||||||||||||||| ||||| ||||||| | |||||| || |||||||||||||| |
|
|
| T |
43564568 |
ggagctgagactagagatggcctttgttatcgtgggagagggatcaattgcttgaactagaggctgttattgcagggatcactgtgagtgcagatttttc |
43564469 |
T |
|
| Q |
105 |
gaacaaatgggtttggactttggagacacgattctatggttgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgt |
204 |
Q |
| |
|
| |||||||||||| || |||| || || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43564468 |
ggacaaatgggtttaga-------gacatgactccgtggctgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgt |
43564376 |
T |
|
| Q |
205 |
ttctgcagaattgttgagagctttcaaagtttttgtggagcgatttggttccattgaaattcacggtttttagatggaagagtattgcaggacagaatca |
304 |
Q |
| |
|
||||||||||||||| || |||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43564375 |
ttctgcagaattgttaagggctttcaaggtttttgtggagcagtttggttccatttaaattcacggtttttagatggaagagtattgcaggacagaatca |
43564276 |
T |
|
| Q |
305 |
tgacgaagggtgctctgaaag |
325 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43564275 |
tgacgaagggtgctctgaaag |
43564255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 175 times since January 2019
Visitors: 3833