View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_45 (Length: 332)
Name: NF0599_low_45
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 45 - 319
Target Start/End: Complemental strand, 7316211 - 7315936
Alignment:
| Q |
45 |
cacaacccagctttcttaaacggcacaaaatttggttggtgtgagatgaattaaaagacttggcagatagctcttattgtagttgacacaaaaaatgaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7316211 |
cacaacccagctttcttaaacggcacaaaatttgattgatgtgagatgaattaaaagacttggcagatagctcttattgtagttgacacaaaaaatgaaa |
7316112 |
T |
 |
| Q |
145 |
acttaatcacaccattttcttttgttgctttcttaaattattgaagcttgaatctttatcacataaaatactgaaaataaatctttaatttctactctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7316111 |
acttaatcacaccattttcttttgttgctttcttaaattattgaagcttgaatctttatcacataaaatactgaaaataaatctttaatttctactatca |
7316012 |
T |
 |
| Q |
245 |
acgtcaaagattaaacatttatgttcccttttcattgtttaa-nnnnnnnngcagtagtgttctttgttagagatg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7316011 |
acgtcaaagattaaacatttatgttcccttttcattgtttaatttttttttgcagtagtgttctttgttagagatg |
7315936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University