View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_50 (Length: 317)
Name: NF0599_low_50
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 13747440 - 13747582
Alignment:
| Q |
96 |
tgtttcatgttcaaaacctcaccttggaacttggctgcttgatagcttgtgaacctaaagtcatcatcttcagcactggctttcaatgcatttgttatct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13747440 |
tgtttcatgttcaaaacctcaccttggaacttggctgcttgatagcttgtgaacctaaagtcatcatcttcagcactggctttcaatgcatttgttatct |
13747539 |
T |
 |
| Q |
196 |
cctcttggatgagacacaaagatgacaatctacgttgcagttc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13747540 |
cctcttggatgagacacaaagatgacaatctacgttgcagttc |
13747582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 96 - 205
Target Start/End: Original strand, 28751479 - 28751588
Alignment:
| Q |
96 |
tgtttcatgttcaaaacctcaccttggaacttggctgcttgatagcttgtgaacctaaagtcatcatcttcagcactggctttcaatgcatttgttatct |
195 |
Q |
| |
|
|||||||| ||||||||||| |||||||| || || || | ||||||||| ||| | || ||||| ||||||||||| |||||||||| ||||||||| |
|
|
| T |
28751479 |
tgtttcatattcaaaacctctccttggaattttgcagcattatagcttgtaaacttgaaatcatcgtcttcagcactcactttcaatgctgttgttatct |
28751578 |
T |
 |
| Q |
196 |
cctcttggat |
205 |
Q |
| |
|
| |||||||| |
|
|
| T |
28751579 |
cttcttggat |
28751588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University