View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_low_50 (Length: 317)

Name: NF0599_low_50
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_low_50
NF0599_low_50
[»] chr5 (1 HSPs)
chr5 (96-238)||(13747440-13747582)
[»] chr8 (1 HSPs)
chr8 (96-205)||(28751479-28751588)


Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 13747440 - 13747582
Alignment:
96 tgtttcatgttcaaaacctcaccttggaacttggctgcttgatagcttgtgaacctaaagtcatcatcttcagcactggctttcaatgcatttgttatct 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13747440 tgtttcatgttcaaaacctcaccttggaacttggctgcttgatagcttgtgaacctaaagtcatcatcttcagcactggctttcaatgcatttgttatct 13747539  T
196 cctcttggatgagacacaaagatgacaatctacgttgcagttc 238  Q
    |||||||||||||||||||||||||||||||||||||||||||    
13747540 cctcttggatgagacacaaagatgacaatctacgttgcagttc 13747582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 96 - 205
Target Start/End: Original strand, 28751479 - 28751588
Alignment:
96 tgtttcatgttcaaaacctcaccttggaacttggctgcttgatagcttgtgaacctaaagtcatcatcttcagcactggctttcaatgcatttgttatct 195  Q
    |||||||| ||||||||||| |||||||| || || || | ||||||||| ||| | || ||||| |||||||||||  ||||||||||  |||||||||    
28751479 tgtttcatattcaaaacctctccttggaattttgcagcattatagcttgtaaacttgaaatcatcgtcttcagcactcactttcaatgctgttgttatct 28751578  T
196 cctcttggat 205  Q
    | ||||||||    
28751579 cttcttggat 28751588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University