View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_51 (Length: 317)
Name: NF0599_low_51
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 289
Target Start/End: Original strand, 5251406 - 5251681
Alignment:
| Q |
14 |
gaagatgaaggaagaagcaatactacgtggaaaattgattgggccattgttgcctccgacccaagcaacccagtgtggggatgatgctcctcctccaact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251406 |
gaagatgaaggaagaagcaatactacgtggaaaattgattgggccattgttgcctccgacccaagcaacccagtgtggggatgatgctcctcctccaact |
5251505 |
T |
|
| Q |
114 |
gttcgatcaaatgcttctcaggaaggttattcaattgcaaacctattgactatgtttcatcatttatgaatgtcttgcttatttccttaacaaaataaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251506 |
gttcgatcaaatgcttctcaggaaggttattcaattgcaaacctattgactatgtttcatcatttatgaatgtcttgcttatttccttaacaaaataaga |
5251605 |
T |
|
| Q |
214 |
gtaaagaccaaatttagtatctcacaatttttggccaatttggcatctcacannnnnnngcaaaccaatttaatcc |
289 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5251606 |
gtaaaggccaaatttagtatctcacaattttcggccaatttggcatctcacatttttttgcaaaccaatttaatcc |
5251681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 152 times since January 2019
Visitors: 3833