View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_53 (Length: 306)
Name: NF0599_low_53
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 10 - 277
Target Start/End: Original strand, 52436076 - 52436340
Alignment:
| Q |
10 |
attattctagctcttaatggcattccatgcatatgatgcatgcatgttctttttgttctgttccttgttataatgataatagcagcaatagcagaaactt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| || |
|
|
| T |
52436076 |
attattctagctcttaatggcattccatgcatatgatgcatgcatgttctttttgttctgttccttgtta--atgatgatagcagcaatagcagaaattt |
52436173 |
T |
|
| Q |
110 |
gtatcttttaatttcactcgtgtatgatgatcatctttagaatatatagcgatcattacaacgaaggtttccacgtcaatttttctacaccgcaacctat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52436174 |
gtatcttttaatttcactcgtgtatgatgatcatctttagaatatatagcgatcattacaacgaaggtttccacgtcaatttttctacaccgcaacctat |
52436273 |
T |
|
| Q |
210 |
taatccaagacaaaataattactagtaagtcatgaaatcaatacatgaactgaaaaatgtgatgtcat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52436274 |
taatccaagacaaaataattactagtaagt-ttgaaatcaatacatgaactgaaaaatgtgatgtcat |
52436340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 474 times since January 2019
Visitors: 3834