View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_55 (Length: 301)
Name: NF0599_low_55
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_55 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 29 - 301
Target Start/End: Complemental strand, 1329985 - 1329715
Alignment:
| Q |
29 |
attaatatcaatagttttattagtatattaaacttt-gcgaaatggctagtttctcataatatagtgaatcgatgtttgaatgccgatttaaaatgctca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
1329985 |
attaatatcaatagttttattagtatattaaacttttgcgaaagggttagtttctcataatatagtgaatcgatgtttgaatgccggttgaaaatgctca |
1329886 |
T |
|
| Q |
128 |
taattaatagttaaattaatgtgtctcgaacaagattatcttcaacgaagaaaatcc-nnnnnnnnnttgcaagcataggaaatgctgcatcatgcatgt |
226 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || || |||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1329885 |
taattaatagtta----aatgtgtctcgaacaagattacttttgaccaagaaaatccaaaaaaaaaattgcaagcataagaaatgctgcatcatgcatgt |
1329790 |
T |
|
| Q |
227 |
ggttttgcaaatttgggtcacattgaaaacagggaccacatatccacattctcaatcacatggaatgttgccaaa |
301 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329789 |
ggttgtgcaaatttgggtcacattgaaaacagcgaccacatatccacattctcaatcacatggaatgttgccaaa |
1329715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 851 times since January 2019
Visitors: 3837