View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_57 (Length: 298)
Name: NF0599_low_57
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 66 - 202
Target Start/End: Complemental strand, 42746203 - 42746067
Alignment:
Q |
66 |
gtcatgctttaatattgattactttgagaaaaaagaaaatttgaattaagaagttgcatatagaaaatgatacacgagactagagtttcttgagatctga |
165 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
42746203 |
gtcatgctttaatattgattactttgaggaaaaagaaaatttgaattaagaagttgcatatagaaaatgacacacgagactagagtttcttgagatctga |
42746104 |
T |
 |
Q |
166 |
acaatcttgaaatctttttcaaattcattgtgctaac |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||| |
|
|
T |
42746103 |
acaatcttgaaatctttttcaaattcattgtggtaac |
42746067 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University