View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_60 (Length: 284)
Name: NF0599_low_60
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 20125118 - 20124927
Alignment:
Q |
1 |
caaactacaaattgattgtt-ccttacaaacatgtcgtatagttacaaattaaaatcttaaaaaccagcttctctgaatcatttagagcaccggtaaatg |
99 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
T |
20125118 |
caaactacaaattgattgtttccttacaaacatgtcgtatagttacaaattaaaatcttaaaaaccagcttctctcaatcatttagggcaccggtaaatg |
20125019 |
T |
 |
Q |
100 |
cattaaaactgacaggctaaagacctatcttaaatgccataaaaaatgtatattgctattagtatctaacatcaagaatcagaagcctatga |
191 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
20125018 |
cattaaaactgacaggcttaagacctatcttaaatgacataaaaaatgtatattactattagtatctaacatcaagaatcagaagcctatga |
20124927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 98 times since January 2019
Visitors: 3832