View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_low_60 (Length: 284)

Name: NF0599_low_60
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_low_60
NF0599_low_60
[»] chr4 (1 HSPs)
chr4 (1-191)||(20124927-20125118)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 20125118 - 20124927
Alignment:
1 caaactacaaattgattgtt-ccttacaaacatgtcgtatagttacaaattaaaatcttaaaaaccagcttctctgaatcatttagagcaccggtaaatg 99  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||    
20125118 caaactacaaattgattgtttccttacaaacatgtcgtatagttacaaattaaaatcttaaaaaccagcttctctcaatcatttagggcaccggtaaatg 20125019  T
100 cattaaaactgacaggctaaagacctatcttaaatgccataaaaaatgtatattgctattagtatctaacatcaagaatcagaagcctatga 191  Q
    |||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
20125018 cattaaaactgacaggcttaagacctatcttaaatgacataaaaaatgtatattactattagtatctaacatcaagaatcagaagcctatga 20124927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 98 times since January 2019
Visitors: 3832