View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_61 (Length: 283)
Name: NF0599_low_61
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 52 - 273
Target Start/End: Complemental strand, 41534301 - 41534080
Alignment:
| Q |
52 |
aatcttcaagttgatctcctcgtcgtcttgagtgacagtttgattagcttccatatgccaagggtttcttgcaatatttgcaaatagctttaaacacacc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41534301 |
aatcttcaagttgatctcctcgtcgtcttgagtgacagtttgattagcttccatatgccaagggtttcttgcaatatttgcaaatagctttaaatacacc |
41534202 |
T |
 |
| Q |
152 |
tttagtaatttaaacttcatcaaaatcattccaaactcctgatgttttctttcgcttcctcttaacaactttatcattttcgggttcttgtgttagagat |
251 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41534201 |
tttagtaatttcaacttcatcaaaatcattccaaactcctgatgttttctttcgcttcctcttaacaactttatcattttcgggttcttgtgttatagat |
41534102 |
T |
 |
| Q |
252 |
tctacttggcttaaactctctg |
273 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
41534101 |
tctacttggcttaaactttctg |
41534080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University