View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_63 (Length: 280)
Name: NF0599_low_63
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 8 - 267
Target Start/End: Complemental strand, 32860017 - 32859759
Alignment:
Q |
8 |
acatgtctgtggtgattgttctttttaacacttacttccatgaagacatgtctgacatcaaagaggagcagctggtgttgtatgcacagatggctaatct |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32860017 |
acatgtctgtggtgattgttctttttaacacttacttccatgaagacatgtctgacatcaaagaggagcagctggtgttgtatgcacagatggctaatct |
32859918 |
T |
 |
Q |
108 |
tgtacacttaatactgcaatggcctgaaatcaatattaaagagattgcagaaattttttcaaaggttttatgcttccaaacttaaatttgttgatataac |
207 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||| |||||||||||| | ||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
T |
32859917 |
tgtacatttaatactacaatggcctgaaatcaatataaaagagattgcaaattttttttccaaggttttatgcttccaaacttaaattacttgatataa- |
32859819 |
T |
 |
Q |
208 |
gctcatcagttgttctcatttgaaatcacacacagcgcactcaatgttatgatgatctct |
267 |
Q |
|
|
||||| |||||||||| ||||||||||| |||| ||||| ||||||||||||||| |
|
|
T |
32859818 |
ttgcatcaattgttctcatgtgaaatcacactcagcattctcaaggttatgatgatctct |
32859759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 133 - 203
Target Start/End: Original strand, 6358305 - 6358374
Alignment:
Q |
133 |
gaaatcaatattaaagagattgcagaaattttttcaaaggttttatgcttccaaacttaaatttgttgata |
203 |
Q |
|
|
|||||||||||||||||||||||||| ||||| |||||| |||||||||| |||| |||||| ||||||| |
|
|
T |
6358305 |
gaaatcaatattaaagagattgcagatttttttccaaagg-tttatgcttcaaaacataaattagttgata |
6358374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University