View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_65 (Length: 271)
Name: NF0599_low_65
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 32429888 - 32430083
Alignment:
| Q |
1 |
aagtaattgttccttattgtggaaagtttgtcatggtaagctccttactaatgaagaaagaaatggcctctaatagtatttgtatgtgttgcaattatcg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32429888 |
aagtaattgttccttattttggaaagtttgtcatggtaagctccttactaatgaagaaagaaacggcctctaatagtatttgtatgtgttgcaattatcg |
32429987 |
T |
|
| Q |
101 |
tgatgactttattatgtgtgttattcgtgactgtg-gggtgtcgatgagcatttggatcattttattagccatgatatgtgaggcaagttctttac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32429988 |
tgatgactttattatgtgtgttattcgtgactgtgagggtgtcgatgagcatttggataattttattagccatgatatgtggggcaagttctttac |
32430083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 80 times since January 2019
Visitors: 3832