View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_69 (Length: 267)
Name: NF0599_low_69
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_69 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 30 - 267
Target Start/End: Complemental strand, 24978720 - 24978483
Alignment:
| Q |
30 |
catgttgggtctgagctgaatggcaagaaacatactgataatcttcttgttgccatccctgacattgaactggttcaacatgagattgcacaaaactata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978720 |
catgttgggtctgagctgaatggcaagaaacatactgataatcttcttgttgccatccctgacattgaactggttcaacatgagattgcacaaaactata |
24978621 |
T |
 |
| Q |
130 |
acacaactgaaatgcctgcataattggaattttgggagcaatctattgctcatgacatttcaggaaaggaagggactagtggagatgtgattgtcgtacc |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978620 |
acacaactgaaatgcctgcatatttggaattttgggagcaatctattgctcaggacatttcaggaaaggaagggactagtggagatgtgattgtcgtacc |
24978521 |
T |
 |
| Q |
230 |
aataatcttgaaagaaaatgctccttgaacactagttc |
267 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24978520 |
aataatcttgaaagaaaatgctccttcaacactagttc |
24978483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University