View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_low_69 (Length: 267)

Name: NF0599_low_69
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_low_69
NF0599_low_69
[»] chr4 (1 HSPs)
chr4 (30-267)||(24978483-24978720)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 30 - 267
Target Start/End: Complemental strand, 24978720 - 24978483
Alignment:
30 catgttgggtctgagctgaatggcaagaaacatactgataatcttcttgttgccatccctgacattgaactggttcaacatgagattgcacaaaactata 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24978720 catgttgggtctgagctgaatggcaagaaacatactgataatcttcttgttgccatccctgacattgaactggttcaacatgagattgcacaaaactata 24978621  T
130 acacaactgaaatgcctgcataattggaattttgggagcaatctattgctcatgacatttcaggaaaggaagggactagtggagatgtgattgtcgtacc 229  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
24978620 acacaactgaaatgcctgcatatttggaattttgggagcaatctattgctcaggacatttcaggaaaggaagggactagtggagatgtgattgtcgtacc 24978521  T
230 aataatcttgaaagaaaatgctccttgaacactagttc 267  Q
    |||||||||||||||||||||||||| |||||||||||    
24978520 aataatcttgaaagaaaatgctccttcaacactagttc 24978483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University