View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_71 (Length: 263)
Name: NF0599_low_71
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 8977483 - 8977232
Alignment:
| Q |
1 |
cgtaaatttgcttaatgttttgtggtgatttttacatcaagctagtcaaacttagcttgcctttgggcacgtgtacttcttcaataatctagagtgttct |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8977483 |
cgtaaatttgcttaatattttgtggtgatttttacatcaagctagtcacacttagcttgcctttgggcacgtgtacttcttcaataatctagggtgttct |
8977384 |
T |
 |
| Q |
101 |
tgtcttatatcaagaaaactctagctttcgaaaagaaataaaagtg-ttttttatgtgaaagatagaatacaaataaaatacaaagacaactatttttta |
199 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
8977383 |
tctcttatatcaagaaaactctaattttcgaaaaaaaat-aaagtgtttttttatgtgaaagatagaatacaaataaaatacaatgaaaactatttttta |
8977285 |
T |
 |
| Q |
200 |
aagaagtttaaaaatatagatgttttaatttgttaacatctctcacaatattct |
253 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
8977284 |
aagaagtttaaaaatatagatg-tttaatttgttaacatctctcacaattttct |
8977232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University