View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_77 (Length: 255)
Name: NF0599_low_77
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_low_77 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 128 - 255
Target Start/End: Original strand, 43751285 - 43751412
Alignment:
Q |
128 |
caagttgatatacatcttaattatttactagtatatcccagtagattttgaacaaaagtatttgaaggaaaaacaaagcgttatcgtccttcaagtcttg |
227 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
43751285 |
caagttgatatacatcttaattatttactagtatatcccagtagattttgaacaaaagtatatgaaggaaaaacaaagcgttatcgtccttcaagtcttg |
43751384 |
T |
 |
Q |
228 |
gataatgggagaacttggaatgttaagc |
255 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
43751385 |
gataatgggagaacttggaatgttaagc |
43751412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 26 - 72
Target Start/End: Original strand, 43751190 - 43751236
Alignment:
Q |
26 |
catattcctatgctaataaatacatggtgagtctttcaatagcttca |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43751190 |
catattcctatgctaataaatacatggtgagtctttcaatagcttca |
43751236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 253
Target Start/End: Original strand, 49164885 - 49164966
Alignment:
Q |
172 |
attttgaacaaaagtatttgaaggaaaaacaaagcgttatcgtccttcaagtcttggataatgggagaacttggaatgttaa |
253 |
Q |
|
|
|||||||||||||||||||||||||| | ||||||| |||| |||||| ||||||||| ||| |||||| |||| |||||| |
|
|
T |
49164885 |
attttgaacaaaagtatttgaaggaacagcaaagcgaaatcgcccttcaggtcttggatgatgagagaacatggattgttaa |
49164966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 633 times since January 2019
Visitors: 3837