View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_81 (Length: 252)
Name: NF0599_low_81
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 33 - 169
Target Start/End: Complemental strand, 13967835 - 13967699
Alignment:
| Q |
33 |
agactcttccagctacttaacttgcctataaaataaatccaagtaacccttaagtaaacaacttcaattataattttatttagctatgttaactatactg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13967835 |
agactcttccagctacttaacttgcctataaaataaatccaaataacccttaagtaaacaacttcaattataattttatttagctatgttaactatactg |
13967736 |
T |
 |
| Q |
133 |
caatagagtgaacaatgacgataatattttgatcatt |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13967735 |
caatagagtgaacaataacgataatattttgatcatt |
13967699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 169 - 240
Target Start/End: Complemental strand, 13967635 - 13967564
Alignment:
| Q |
169 |
ttacagaaattgttcccaccaccaaaaaagtttgttagtatctagaaggtagttttttcctcaaggtatatt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13967635 |
ttacagaaattgttcccaccaccaaaaaagtttgttagtatctagaaggtagttttttcctcaaggtatatt |
13967564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 144
Target Start/End: Complemental strand, 13965480 - 13965446
Alignment:
| Q |
110 |
atttagctatgttaactatactgcaatagagtgaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
13965480 |
atttagctatgttaactatactgcaatatagtgaa |
13965446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University