View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_low_84 (Length: 248)

Name: NF0599_low_84
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_low_84
NF0599_low_84
[»] chr5 (1 HSPs)
chr5 (1-225)||(8436730-8436953)


Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 8436730 - 8436953
Alignment:
1 taaactacaaaaatgtaggcccatgcatcttgatgaagatttcatggtggcacttgcgaaaattaaggataaagtcaattgtaacaaagtgtttggtacg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
8436730 taaactacaaaaatgtaggcccatgcatcttgatgaagatttcatggtggcacttgcgaaaattgaggataaagtcaattgtaacaaagtgtttggtacg 8436829  T
101 tataagaacagtgagattataattggagcagaagtggaattcaatggttatgcttgtgcagtaataaaaggtgagaatgggaatcattggtgcgtgcaat 200  Q
    ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
8436830 tataagaacagtgagattataattggagcagaagttgaattcaat-gttatgcttgtgcagtaataaaaggtgagaatgggaatcattggtgcgtgccat 8436928  T
201 taataagcttgttctttacaagttt 225  Q
    |||||||||||||||||||||||||    
8436929 taataagcttgttctttacaagttt 8436953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 726 times since January 2019
Visitors: 3837