View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_low_88 (Length: 231)

Name: NF0599_low_88
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_low_88
NF0599_low_88
[»] chr5 (1 HSPs)
chr5 (7-231)||(8436383-8436607)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 8436383 - 8436607
Alignment:
7 acgttgtctgaaacatgcattataaaagtccatcgagaacatcactcaaatagttatatgaagcaatgacactttaatatggaagcgtaacaattcttaa 106  Q
    |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||    
8436383 acgttgtctgaaacatgcatgataaaagtccattgagaacatcactcaaatagttatatgaagcaatggcactttaatacggaagcgtaacaattcttaa 8436482  T
107 agtttttgtatcacttttgtcagttgtcgaatttccgtatagcaaactgtataaatcttcaattcgaatacatactgatgcctcataattcatataggtt 206  Q
    |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
8436483 agtttttgtatcacttttgtgagctgtcgaatttccgtatagcaaactgtataaatcttcatttcgaatacatactgatgcctcataattcatataggtt 8436582  T
207 cttttagggcatgaatttttattgt 231  Q
    |||||||||||||||||||||||||    
8436583 cttttagggcatgaatttttattgt 8436607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1200 times since January 2019
Visitors: 3841