View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_low_91 (Length: 202)
Name: NF0599_low_91
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_low_91 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 6 - 109
Target Start/End: Complemental strand, 3041923 - 3041820
Alignment:
| Q |
6 |
gtcgaataatattacttatttgtggacgttcaataattcctatatctgtttcattttgtgaattgtagaattcaaagaaaaaattacaaacatagaagtg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3041923 |
gtcgaataatattacttatttgtggacgttcaataattcctatatctgtttcattttgtgaattgtagaattcaaagaaaaaattacgaacatagaagtg |
3041824 |
T |
 |
| Q |
106 |
gcac |
109 |
Q |
| |
|
|||| |
|
|
| T |
3041823 |
gcac |
3041820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 99; Significance: 4e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 104 - 202
Target Start/End: Complemental strand, 8341917 - 8341819
Alignment:
| Q |
104 |
tggcacattgcagaggcccttggcacatcagatactaacttgagaatgagatacttcttttttaggtccaaggaaatatcagcaataatcaacgtcttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8341917 |
tggcacattgcagaggcccttggcacatcagatactaacttgagaatgagatacttcttttttaggtccaaggaaatatcagcaataatcaacgtcttt |
8341819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 107 - 202
Target Start/End: Original strand, 4426850 - 4426945
Alignment:
| Q |
107 |
cacattgcagaggcccttggcacatcagatactaacttgagaatgagatacttcttttttaggtccaaggaaatatcagcaataatcaacgtcttt |
202 |
Q |
| |
|
|||||| | |||||||||||||||||||||| | ||||||||| ||||||| |||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
4426850 |
cacattcctgaggcccttggcacatcagatattgttttgagaatgtcgtacttctcctttaagtccacggaaatatcagcaataatcaatgtcttt |
4426945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University