View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_low_91 (Length: 202)

Name: NF0599_low_91
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_low_91
NF0599_low_91
[»] chr2 (1 HSPs)
chr2 (6-109)||(3041820-3041923)
[»] chr5 (1 HSPs)
chr5 (104-202)||(8341819-8341917)
[»] chr8 (1 HSPs)
chr8 (107-202)||(4426850-4426945)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 6 - 109
Target Start/End: Complemental strand, 3041923 - 3041820
Alignment:
6 gtcgaataatattacttatttgtggacgttcaataattcctatatctgtttcattttgtgaattgtagaattcaaagaaaaaattacaaacatagaagtg 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
3041923 gtcgaataatattacttatttgtggacgttcaataattcctatatctgtttcattttgtgaattgtagaattcaaagaaaaaattacgaacatagaagtg 3041824  T
106 gcac 109  Q
    ||||    
3041823 gcac 3041820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 99; Significance: 4e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 104 - 202
Target Start/End: Complemental strand, 8341917 - 8341819
Alignment:
104 tggcacattgcagaggcccttggcacatcagatactaacttgagaatgagatacttcttttttaggtccaaggaaatatcagcaataatcaacgtcttt 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8341917 tggcacattgcagaggcccttggcacatcagatactaacttgagaatgagatacttcttttttaggtccaaggaaatatcagcaataatcaacgtcttt 8341819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 107 - 202
Target Start/End: Original strand, 4426850 - 4426945
Alignment:
107 cacattgcagaggcccttggcacatcagatactaacttgagaatgagatacttcttttttaggtccaaggaaatatcagcaataatcaacgtcttt 202  Q
    |||||| | |||||||||||||||||||||| |   |||||||||   |||||||  |||| ||||| ||||||||||||||||||||| ||||||    
4426850 cacattcctgaggcccttggcacatcagatattgttttgagaatgtcgtacttctcctttaagtccacggaaatatcagcaataatcaatgtcttt 4426945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University