View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0600-Insertion-7 (Length: 46)
Name: NF0600-Insertion-7
Description: NF0600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0600-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.00000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 46
Target Start/End: Original strand, 44110275 - 44110313
Alignment:
| Q |
8 |
gtttgcatttcatgaactgaatcaatttatactagttta |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44110275 |
gtttgcatttcatgaactgaatcaatttatactagttta |
44110313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University