View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0600-Insertion-9 (Length: 137)
Name: NF0600-Insertion-9
Description: NF0600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0600-Insertion-9 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
[»] chr4 (4 HSPs) |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 44; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Original strand, 3790859 - 3790906
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
3790859 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
3790906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 2e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Original strand, 12811296 - 12811343
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
12811296 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
12811343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 2e-16; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Complemental strand, 1655095 - 1655048
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
1655095 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
1655048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Original strand, 9129107 - 9129154
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
9129107 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
9129154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Complemental strand, 37152752 - 37152705
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
37152752 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
37152705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Complemental strand, 45223069 - 45223022
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
45223069 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
45223022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 2e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Complemental strand, 23781023 - 23780976
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
23781023 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
23780976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 90 - 137
Target Start/End: Original strand, 52635920 - 52635967
Alignment:
Q |
90 |
aaatgggttcaggatatgctgaagatttatatagctgggtttccatga |
137 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
52635920 |
aaatgggttcatgatatgctgaagatttatatagctgggtttccatga |
52635967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University