View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_high_15 (Length: 332)
Name: NF0601_high_15
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 9e-61; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 168 - 328
Target Start/End: Original strand, 35010027 - 35010191
Alignment:
Q |
168 |
ttaatatgataattaaaagggtaaattggatatttcagttgaattaaaataggcatatccagtttctaaggccatacaccac-ttacgaaatgcgaagat |
266 |
Q |
|
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
T |
35010027 |
ttaatattataattaaaagggtaaattggatatttctgttgaattaaaataggcatatccagtttctaaggccatacaccactttacgaaatgcggagat |
35010126 |
T |
 |
Q |
267 |
ctttctttccctttcctg---gaaaaagaaatactccatcctcgtcttccaatcccaattttgct |
328 |
Q |
|
|
|||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
T |
35010127 |
ctttctttccctttcctgaaaaaaaaaaaaatactccatccccgtcttccaatcccaattttgct |
35010191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 131 - 170
Target Start/End: Original strand, 35008985 - 35009024
Alignment:
Q |
131 |
aggactgtgttttacctattgtagtgggtaaaccttatta |
170 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
35008985 |
aggactgtgttttacctattgcagtgggtaaaccttatta |
35009024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 35008944 - 35008986
Alignment:
Q |
36 |
tgggagatgatttctttgttactttacatgcagctgtaggtccag |
80 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
35008944 |
tgggagatgatttct--gttactttacatgcagctgtaggtccag |
35008986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 34 - 80
Target Start/End: Original strand, 52574558 - 52574604
Alignment:
Q |
34 |
gttgggagatgatttctttgttactttacatgcagctgtaggtccag |
80 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52574558 |
gttgggagatgatttctttgttactttacatgcagctgtaggtccag |
52574604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3058 times since January 2019
Visitors: 3831