View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_high_19 (Length: 313)
Name: NF0601_high_19
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0601_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 104 - 284
Target Start/End: Original strand, 4620431 - 4620611
Alignment:
| Q |
104 |
tttcatctgattgttgaatcaatacatagagaaacctaataattggataaaacgatgaaagattggtaaagaaatcgatagcaaatttccgtaataacgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4620431 |
tttcatctgattgttgaatcaatacatagagaaacctaataattggataaaacgatgaaagattgataaagaaatcgatagcaaatttccgtaataacgt |
4620530 |
T |
|
| Q |
204 |
gataaattttgaaaattggtacctgaaagtgaaatcccaacacgaattttctgagctttgaagcgaaacgctttttgtgag |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4620531 |
gataaattttgaaaattggtacctgaaagtgaaatcccaacacgaattttctgagctttgaagcgaaacgctttttgtgag |
4620611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3045 times since January 2019
Visitors: 3831