View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_high_25 (Length: 304)
Name: NF0601_high_25
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0601_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 8534528 - 8534386
Alignment:
| Q |
1 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgctatggggcttcttgctatgggttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8534528 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgctatggggcttcttgctatgggttcaa |
8534429 |
T |
 |
| Q |
101 |
ccatagttgttctctctaaattcgagatgcacgacatgctttc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8534428 |
ccatagttgttctctctaaattcgagatgcacgacatgctttc |
8534386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 8599767 - 8599625
Alignment:
| Q |
1 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgctatggggcttcttgctatgggttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8599767 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgctatggggcttcttgctatgggttcaa |
8599668 |
T |
 |
| Q |
101 |
ccatagttgttctctctaaattcgagatgcacgacatgctttc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8599667 |
ccatagttgttctctctaaattcgagatgcacgacatgctttc |
8599625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 8613659 - 8613801
Alignment:
| Q |
1 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgctatggggcttcttgctatgggttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8613659 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgctatggggcttcttgctatgggttcaa |
8613758 |
T |
 |
| Q |
101 |
ccatagttgttctctctaaattcgagatgcacgacatgctttc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8613759 |
ccatagttgttctctctaaattcgagatgcacgacatgctttc |
8613801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 143
Target Start/End: Complemental strand, 14752154 - 14752039
Alignment:
| Q |
25 |
ttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgctatggggcttcttgctatgggttcaaccatagttgttctctctaaattcg |
124 |
Q |
| |
|
|||||||| || |||| |||||||| ||||||||||| || |||| ||| |||||||| || | |||||||| || ||||||||||| || |||| |
|
|
| T |
14752154 |
ttcatatgcacaattcccatgtttcacatatacggtctagcaatgttcgct---gggcttctctctttaggttcaacaatcgttgttctctccaagttcg |
14752058 |
T |
 |
| Q |
125 |
agatgcacgacatgctttc |
143 |
Q |
| |
|
| ||||| ||||||||||| |
|
|
| T |
14752057 |
aaatgcatgacatgctttc |
14752039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University