View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_high_26 (Length: 296)
Name: NF0601_high_26
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 13 - 267
Target Start/End: Original strand, 33108671 - 33108925
Alignment:
Q |
13 |
aatatagcttatttaaagagtttgactttattttattttgttatgtaagtagtttatacattgaccctcatatgactagaacttatactatactataagt |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
33108671 |
aatatagcttatttaaagagtttgactttattttattttgttatgtaagtagtttatacattgacactcatatgactagaatttatactatactataagt |
33108770 |
T |
 |
Q |
113 |
acttagttatactgtttatcttaacatggtctatatggaattgcttgcttatatagaaacttacatatttttcttgtgcagtgaaattgtaatcaggtaa |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33108771 |
acttagttatactgtttatcttaacatggtctatatggaattgcttgcttatatagaaacttacatatttttcttgtgcagtgaaattgtaatcaggtaa |
33108870 |
T |
 |
Q |
213 |
caaagttggtgatggcaggacaactaggagtgcttaatgcactcgatgtggcgaa |
267 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33108871 |
caaagttggtgatggcaggacaactaggagtgcttaatgcactcgatgtggcgaa |
33108925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2488 times since January 2019
Visitors: 3819