View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_high_6 (Length: 484)
Name: NF0601_high_6
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 3e-24; HSPs: 16)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 262 - 331
Target Start/End: Complemental strand, 30747880 - 30747811
Alignment:
Q |
262 |
gacgaagtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgata |
331 |
Q |
|
|
||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
30747880 |
gacgaagtcttttagagtggaggaagcgacaatgggtccagtagtggtatcgaggattgcgattttgata |
30747811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 268 - 364
Target Start/End: Complemental strand, 29870468 - 29870372
Alignment:
Q |
268 |
gtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta |
364 |
Q |
|
|
|||||||||||||||||| ||||||| | ||||||| ||||||||||||||||||||||||||||| | ||| | |||| ||||| ||||||||||| |
|
|
T |
29870468 |
gtcttttggagtggaggaggtgacaacgagtccggtggtggtatcgaggattgcgattttgatagtgagggcgtgggtcagagctgcgtgcccatta |
29870372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 364
Target Start/End: Complemental strand, 29851577 - 29851485
Alignment:
Q |
268 |
gtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta |
364 |
Q |
|
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
T |
29851577 |
gtcttttggagtggaggagatgacaataagtccggtggtggtatcgaggattgcgattttgatagtcagggc----gtcggagctctgtgcccatta |
29851485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 29870463 - 29870372
Alignment:
Q |
1 |
ttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta |
92 |
Q |
|
|
||||||||||||| ||||||| | ||||||| ||||||||||||||||||||||||||||| | ||| | |||| ||||| ||||||||||| |
|
|
T |
29870463 |
ttggagtggaggaggtgacaacgagtccggtggtggtatcgaggattgcgattttgatagtgagggcgtgggtcagagctgcgtgcccatta |
29870372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 30747866 - 30747811
Alignment:
Q |
4 |
gagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgata |
59 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
30747866 |
gagtggaggaagcgacaatgggtccagtagtggtatcgaggattgcgattttgata |
30747811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 29851572 - 29851485
Alignment:
Q |
1 |
ttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta |
92 |
Q |
|
|
||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
T |
29851572 |
ttggagtggaggagatgacaataagtccggtggtggtatcgaggattgcgattttgatagtcagggc----gtcggagctctgtgcccatta |
29851485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 269 - 330
Target Start/End: Original strand, 30244267 - 30244328
Alignment:
Q |
269 |
tcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgat |
330 |
Q |
|
|
||||||||||||||||| ||||||| | |||| || |||| ||||||||||||||||||||| |
|
|
T |
30244267 |
tcttttggagtggaggaggtgacaacgagtccagtcgtggcatcgaggattgcgattttgat |
30244328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 377
Target Start/End: Complemental strand, 30398633 - 30398564
Alignment:
Q |
307 |
ggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccattaacaaagtctgatc |
377 |
Q |
|
|
||||||||||||||||||||||| | || ||||| ||||||||||| |||||||||| | |||||||||| |
|
|
T |
30398633 |
ggtatcgaggattgcgattttgacaatcggggcatgggtcggagctctgtgcccattagc-aagtctgatc |
30398564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 105
Target Start/End: Complemental strand, 30398633 - 30398564
Alignment:
Q |
35 |
ggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccattaacaaagtctgatc |
105 |
Q |
|
|
||||||||||||||||||||||| | || ||||| ||||||||||| |||||||||| | |||||||||| |
|
|
T |
30398633 |
ggtatcgaggattgcgattttgacaatcggggcatgggtcggagctctgtgcccattagc-aagtctgatc |
30398564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 29870737 - 29870704
Alignment:
Q |
198 |
tgtttggatttcaactgctcaaaaatctttattt |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
29870737 |
tgtttggatttcaactgctcaaaaatctttattt |
29870704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 30058848 - 30058815
Alignment:
Q |
198 |
tgtttggatttcaactgctcaaaaatctttattt |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
30058848 |
tgtttggatttcaactgctcaaaaatctttattt |
30058815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 30244271 - 30244328
Alignment:
Q |
1 |
ttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgat |
58 |
Q |
|
|
||||||||||||| ||||||| | |||| || |||| ||||||||||||||||||||| |
|
|
T |
30244271 |
ttggagtggaggaggtgacaacgagtccagtcgtggcatcgaggattgcgattttgat |
30244328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 262 - 299
Target Start/End: Complemental strand, 30481585 - 30481548
Alignment:
Q |
262 |
gacgaagtcttttggagtggaggaagtgacaatgggtc |
299 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
T |
30481585 |
gacgcagtcttttggagtggaggaagtgacaatgggtc |
30481548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 30481883 - 30481850
Alignment:
Q |
198 |
tgtttggatttcaactgctcaaaaatctttattt |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
30481883 |
tgtttggatttcaactgctcaaaaatctttattt |
30481850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Original strand, 30678795 - 30678828
Alignment:
Q |
198 |
tgtttggatttcaactgctcaaaaatctttattt |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
30678795 |
tgtttggatttcaactgctcaaaaatctttattt |
30678828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 198 - 231
Target Start/End: Original strand, 30714638 - 30714671
Alignment:
Q |
198 |
tgtttggatttcaactgctcaaaaatctttattt |
231 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| |
|
|
T |
30714638 |
tgtttgcatttcaactgctcaaaaatctttattt |
30714671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3037 times since January 2019
Visitors: 3831