View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_12 (Length: 514)
Name: NF0601_low_12
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0601_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 30 - 223
Target Start/End: Complemental strand, 18993413 - 18993220
Alignment:
| Q |
30 |
ccatcaggattaacattatcagcatcaacatcaacctcagagcatgaaacggcgtcgttccaatcaagtgcaggaaacgacgatgacgaaacgcggcgtt |
129 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18993413 |
ccatcatgattaacattatcagcatcaacatcaacctcagagcatgaaacggcgtcgttccaatcaagtgcaggaaacgacgatgatgaaacgcggcgtt |
18993314 |
T |
|
| Q |
130 |
taacggaagaagcgaaatgaaaacgacgagtgatgaaggaagaagcgtgttctcgttgttgttgaagaaaagagtgagattgtgattgaggttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
18993313 |
taacggaagaagcgaaatgaaaacgacgagtgatgaaggaagaagcgtgttctcgttgttgaagaagaaaagagtgagattgtgattgtggttt |
18993220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 321 - 441
Target Start/End: Complemental strand, 18993122 - 18993004
Alignment:
| Q |
321 |
gttctgacggtgaggtgatgagtggtttctatgcttcgcaacatctttgttgagttcgtgtcacttacacaaacatgggaagaagaaagagatttaacac |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
18993122 |
gttctgacggtgaggtgatgagtggtttctatgcttcgcaacat-tttgttgagttcgt-tcactcacccaaacatgggaagaagaaagagatttaacac |
18993025 |
T |
|
| Q |
421 |
tttcactaacaacctatgcta |
441 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18993024 |
tttcactaacaacctatgcta |
18993004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2829 times since January 2019
Visitors: 3829