View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0601_low_14 (Length: 484)

Name: NF0601_low_14
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0601_low_14
NF0601_low_14
[»] chr5 (16 HSPs)
chr5 (262-331)||(30747811-30747880)
chr5 (268-364)||(29870372-29870468)
chr5 (268-364)||(29851485-29851577)
chr5 (1-92)||(29870372-29870463)
chr5 (4-59)||(30747811-30747866)
chr5 (1-92)||(29851485-29851572)
chr5 (269-330)||(30244267-30244328)
chr5 (307-377)||(30398564-30398633)
chr5 (35-105)||(30398564-30398633)
chr5 (198-231)||(29870704-29870737)
chr5 (198-231)||(30058815-30058848)
chr5 (1-58)||(30244271-30244328)
chr5 (262-299)||(30481548-30481585)
chr5 (198-231)||(30481850-30481883)
chr5 (198-231)||(30678795-30678828)
chr5 (198-231)||(30714638-30714671)


Alignment Details
Target: chr5 (Bit Score: 58; Significance: 3e-24; HSPs: 16)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 262 - 331
Target Start/End: Complemental strand, 30747880 - 30747811
Alignment:
262 gacgaagtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgata 331  Q
    ||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||    
30747880 gacgaagtcttttagagtggaggaagcgacaatgggtccagtagtggtatcgaggattgcgattttgata 30747811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 268 - 364
Target Start/End: Complemental strand, 29870468 - 29870372
Alignment:
268 gtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta 364  Q
    |||||||||||||||||| ||||||| | ||||||| ||||||||||||||||||||||||||||| | ||| | |||| ||||| |||||||||||    
29870468 gtcttttggagtggaggaggtgacaacgagtccggtggtggtatcgaggattgcgattttgatagtgagggcgtgggtcagagctgcgtgcccatta 29870372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 364
Target Start/End: Complemental strand, 29851577 - 29851485
Alignment:
268 gtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta 364  Q
    ||||||||||||||||||  |||||||  ||||||| ||||||||||||||||||||||||||||||| |||    |||||||||| ||||||||||    
29851577 gtcttttggagtggaggagatgacaataagtccggtggtggtatcgaggattgcgattttgatagtcagggc----gtcggagctctgtgcccatta 29851485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 29870463 - 29870372
Alignment:
1 ttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta 92  Q
    ||||||||||||| ||||||| | ||||||| ||||||||||||||||||||||||||||| | ||| | |||| ||||| |||||||||||    
29870463 ttggagtggaggaggtgacaacgagtccggtggtggtatcgaggattgcgattttgatagtgagggcgtgggtcagagctgcgtgcccatta 29870372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 30747866 - 30747811
Alignment:
4 gagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgata 59  Q
    |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||    
30747866 gagtggaggaagcgacaatgggtccagtagtggtatcgaggattgcgattttgata 30747811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 29851572 - 29851485
Alignment:
1 ttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta 92  Q
    |||||||||||||  |||||||  ||||||| ||||||||||||||||||||||||||||||| |||    |||||||||| ||||||||||    
29851572 ttggagtggaggagatgacaataagtccggtggtggtatcgaggattgcgattttgatagtcagggc----gtcggagctctgtgcccatta 29851485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 269 - 330
Target Start/End: Original strand, 30244267 - 30244328
Alignment:
269 tcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgat 330  Q
    ||||||||||||||||| ||||||| | |||| || |||| |||||||||||||||||||||    
30244267 tcttttggagtggaggaggtgacaacgagtccagtcgtggcatcgaggattgcgattttgat 30244328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 377
Target Start/End: Complemental strand, 30398633 - 30398564
Alignment:
307 ggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccattaacaaagtctgatc 377  Q
    ||||||||||||||||||||||| | ||  ||||| ||||||||||| |||||||||| | ||||||||||    
30398633 ggtatcgaggattgcgattttgacaatcggggcatgggtcggagctctgtgcccattagc-aagtctgatc 30398564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 105
Target Start/End: Complemental strand, 30398633 - 30398564
Alignment:
35 ggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccattaacaaagtctgatc 105  Q
    ||||||||||||||||||||||| | ||  ||||| ||||||||||| |||||||||| | ||||||||||    
30398633 ggtatcgaggattgcgattttgacaatcggggcatgggtcggagctctgtgcccattagc-aagtctgatc 30398564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 29870737 - 29870704
Alignment:
198 tgtttggatttcaactgctcaaaaatctttattt 231  Q
    ||||||||||||||||||||||||||||||||||    
29870737 tgtttggatttcaactgctcaaaaatctttattt 29870704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 30058848 - 30058815
Alignment:
198 tgtttggatttcaactgctcaaaaatctttattt 231  Q
    ||||||||||||||||||||||||||||||||||    
30058848 tgtttggatttcaactgctcaaaaatctttattt 30058815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 30244271 - 30244328
Alignment:
1 ttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgat 58  Q
    ||||||||||||| ||||||| | |||| || |||| |||||||||||||||||||||    
30244271 ttggagtggaggaggtgacaacgagtccagtcgtggcatcgaggattgcgattttgat 30244328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 262 - 299
Target Start/End: Complemental strand, 30481585 - 30481548
Alignment:
262 gacgaagtcttttggagtggaggaagtgacaatgggtc 299  Q
    |||| |||||||||||||||||||||||||||||||||    
30481585 gacgcagtcttttggagtggaggaagtgacaatgggtc 30481548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 30481883 - 30481850
Alignment:
198 tgtttggatttcaactgctcaaaaatctttattt 231  Q
    ||||||||||||||||||||||||||||||||||    
30481883 tgtttggatttcaactgctcaaaaatctttattt 30481850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 231
Target Start/End: Original strand, 30678795 - 30678828
Alignment:
198 tgtttggatttcaactgctcaaaaatctttattt 231  Q
    ||||||||||||||||||||||||||||||||||    
30678795 tgtttggatttcaactgctcaaaaatctttattt 30678828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 198 - 231
Target Start/End: Original strand, 30714638 - 30714671
Alignment:
198 tgtttggatttcaactgctcaaaaatctttattt 231  Q
    |||||| |||||||||||||||||||||||||||    
30714638 tgtttgcatttcaactgctcaaaaatctttattt 30714671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2976 times since January 2019
Visitors: 3831