View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0601_low_17 (Length: 446)

Name: NF0601_low_17
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0601_low_17
NF0601_low_17
[»] chr4 (1 HSPs)
chr4 (190-446)||(1090354-1090610)


Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 190 - 446
Target Start/End: Original strand, 1090354 - 1090610
Alignment:
190 tagccttgcggtagtttgtgataaagaatctctatgatttagggataaggatggtggccaataatttaaagcatagatgataaaccccattttctaaaag 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1090354 tagccttgcggtagtttgtgataaagaatctctatgatttagggataaggatggtggccaataatttaaagcatagatgataaaccccattttctaaaag 1090453  T
290 aaatagaaatgcacacatacttataaacagtgacaaatatatcatatcaaattgatatatcctaaaaactccatccattatggaaataatctttactcta 389  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1090454 aaatagaaatgcacacatatttataaacagtgacaaatatatcatatcaaattgatatatcctaaaaactccatccattatggaaataatctttactcta 1090553  T
390 taatttatggccttgacgtgcgtttggcattttgcctagtttgaatcatacgagcaa 446  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1090554 taatttatggccttgacgtgcgtttggcattttgcctagtttgaatcatacgagcaa 1090610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2570 times since January 2019
Visitors: 3822