View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_35 (Length: 319)
Name: NF0601_low_35
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0601_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 43475730 - 43475935
Alignment:
| Q |
16 |
ggagcagagaatggagatgacctttgttctcatgggagagggatcaatttcttgagctagaggtttttattgtagagtgcagatttttcgaacaaatggg |
115 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43475730 |
ggagctgagaatggagatggcctttgttctcatggg-gagggatcaatttcttgagctagaggtttttattgtagagtgcagatttttcggacaaatggg |
43475828 |
T |
|
| Q |
116 |
tttggactttggagacacgattctatggttgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgtttctgcagaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43475829 |
tttggactttggagacacgattctatggttgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgtttctgcagaat |
43475928 |
T |
|
| Q |
216 |
tgttgag |
222 |
Q |
| |
|
||||||| |
|
|
| T |
43475929 |
tgttgag |
43475935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 43564568 - 43564361
Alignment:
| Q |
16 |
ggagcagagaatggagatgacctttgttctcatgggagagggatcaatttcttgagctagaggtttttattgtag-----------agtgcagatttttc |
104 |
Q |
| |
|
||||| |||| | |||||| |||||||| || ||||||||||||||||| ||||| ||||||| | |||||| || |||||||||||||| |
|
|
| T |
43564568 |
ggagctgagactagagatggcctttgttatcgtgggagagggatcaattgcttgaactagaggctgttattgcagggatcactgtgagtgcagatttttc |
43564469 |
T |
|
| Q |
105 |
gaacaaatgggtttggactttggagacacgattctatggttgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgt |
204 |
Q |
| |
|
| |||||||||||| || |||| || || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43564468 |
ggacaaatgggtttaga-------gacatgactccgtggctgggtacacggtaaagtctgcatatatactgttgcagagatactgtgagcataattctgt |
43564376 |
T |
|
| Q |
205 |
ttctgcagaattgtt |
219 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43564375 |
ttctgcagaattgtt |
43564361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 39 times since January 2019
Visitors: 3832