View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_37 (Length: 313)
Name: NF0601_low_37
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 104 - 284
Target Start/End: Original strand, 4620431 - 4620611
Alignment:
Q |
104 |
tttcatctgattgttgaatcaatacatagagaaacctaataattggataaaacgatgaaagattggtaaagaaatcgatagcaaatttccgtaataacgt |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
4620431 |
tttcatctgattgttgaatcaatacatagagaaacctaataattggataaaacgatgaaagattgataaagaaatcgatagcaaatttccgtaataacgt |
4620530 |
T |
 |
Q |
204 |
gataaattttgaaaattggtacctgaaagtgaaatcccaacacgaattttctgagctttgaagcgaaacgctttttgtgag |
284 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4620531 |
gataaattttgaaaattggtacctgaaagtgaaatcccaacacgaattttctgagctttgaagcgaaacgctttttgtgag |
4620611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2169 times since January 2019
Visitors: 3815