View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_44 (Length: 297)
Name: NF0601_low_44
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 101 - 214
Target Start/End: Complemental strand, 45301398 - 45301283
Alignment:
Q |
101 |
atcgttggcatctaattcttggttggtggtgatttacactgctcaacctgacggtatcggt--tcacgcgcttcagtttggtggctcacatgtcttcagg |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
T |
45301398 |
atcgttggcatctaattcttggttggtggtgatttacactgctcaacctgacggtatcggttctcacgcgcttcagtttggtggctcacatgtcttaagg |
45301299 |
T |
 |
Q |
199 |
aaggaaattcgtggtt |
214 |
Q |
|
|
|||||||| ||||||| |
|
|
T |
45301298 |
aaggaaatccgtggtt |
45301283 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University