View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0601_low_44 (Length: 297)

Name: NF0601_low_44

Description: NF0601

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0601_low_44

[»] chr4 (1 HSPs)

Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 97; E-Value: 1e-47

Query Start/End: Original strand, 101 - 214

Target Start/End: Complemental strand, 45301398 - 45301283

Alignment:

Q	101	atcgttggcatctaattcttggttggtggtgatttacactgctcaacctgacggtatcggt--tcacgcgcttcagtttggtggctcacatgtcttcagg	198	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|
T	45301398	atcgttggcatctaattcttggttggtggtgatttacactgctcaacctgacggtatcggttctcacgcgcttcagtttggtggctcacatgtcttaagg	45301299	T

Q	199	aaggaaattcgtggtt	214	Q
		\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|
T	45301298	aaggaaatccgtggtt	45301283	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]