View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_49 (Length: 267)
Name: NF0601_low_49
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0601_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 30 - 223
Target Start/End: Original strand, 40658707 - 40658900
Alignment:
| Q |
30 |
agaagaaataggatgagaatgacacggactgggtcccccggatttgctgctataacattttcacgtcctttcacagtgtgatttatctcaactgctaatt |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
40658707 |
agaagaaataggatgaggatgacacggactgggtcccccggatttgctgctataacattttcacgtcctttcaaagtgtgattgatctcaactgctaatt |
40658806 |
T |
 |
| Q |
130 |
tgagatcaaacagttcaatttcaaatttgaagctcagttttgtagtaatacgatctcaactgtccatatcaaaccgctcatatttgttagagct |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40658807 |
tgagatcaaacaattcaatttcaaatttgaagctcagttttgtagtaatacgatctcaactgtccatatcaaaccgctcatatttgttagagct |
40658900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University