View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_51 (Length: 261)
Name: NF0601_low_51
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_low_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 142 - 232
Target Start/End: Complemental strand, 11531628 - 11531538
Alignment:
Q |
142 |
cactattgtcggtatttccatcagaacgtgcaccataattgattacattgaaaagcttgttttgaatttgacggtgtgcttctgcaataca |
232 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11531628 |
cactattgtcggtatttccatcagaacgtgcaccataattgatcacattgaaaagcttgttttgaatttgacggtgtgcttctgcaataca |
11531538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 11531769 - 11531723
Alignment:
Q |
1 |
ctccatctgcatgcatcactccatgcttttaaaaatgccttcataag |
47 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11531769 |
ctccatctgcatgcatcactccatgcttttaaaaatgccttcataag |
11531723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 2 - 47
Target Start/End: Complemental strand, 26300070 - 26300025
Alignment:
Q |
2 |
tccatctgcatgcatcactccatgcttttaaaaatgccttcataag |
47 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26300070 |
tccatttgcatgcatcactccatgcttttaaaaatgccttcataag |
26300025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 47
Target Start/End: Complemental strand, 13614885 - 13614840
Alignment:
Q |
2 |
tccatctgcatgcatcactccatgcttttaaaaatgccttcataag |
47 |
Q |
|
|
||||| ||||||||| ||||| |||||||||||||||||||||||| |
|
|
T |
13614885 |
tccatttgcatgcattactccctgcttttaaaaatgccttcataag |
13614840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 138 - 181
Target Start/End: Original strand, 10978044 - 10978087
Alignment:
Q |
138 |
accacactattgtcggtatttccatcagaacgtgcaccataatt |
181 |
Q |
|
|
||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
T |
10978044 |
accacactattgtaggtattgctatcagaacgtgcaccataatt |
10978087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University