View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_52 (Length: 254)
Name: NF0601_low_52
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0601_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 47691693 - 47691550
Alignment:
| Q |
1 |
atgatgtgatgtaaatttattaagcatgtggtacgaaacatattaaaaaatgcacaaagaaaatatgtatttcctcatatttgtgtttgaactcttttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
47691693 |
atgatgtgatgtaaatttattaagcatgtggtacgaaacatattaaaaagtgca-aaagaaaatatgtattttctcatatttgcgtttgaactcttttag |
47691595 |
T |
 |
| Q |
101 |
aaaatatttcatgatttagtctcattaaagctcatgatcttccttc |
146 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47691594 |
-aaatatttcatgttttagtctcattaaagctcatgatcttccttc |
47691550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University