View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_53 (Length: 251)
Name: NF0601_low_53
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0601_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 45682231 - 45681998
Alignment:
| Q |
16 |
ataagcttaattaaaggtatgtcctacaaa-gattaatatcacataatcccatggacaataatgccacacatttctttccttatgtaagtcatcttggct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45682231 |
ataagcttaattaaaggtatgtcctacaaaagattaatatcacataatcccatggacaataatgccacacatttctttccttatgtaagtcatcttggct |
45682132 |
T |
|
| Q |
115 |
gcagaatataaatgggggaccaggggccacaattactaaaatttcnnnnnnnnnnnnnnnnnnnnnnnntatataaacaatcccagctcagcattgataa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45682131 |
gcagaatataaatgggggaccaggggccacaattactaaaatttccacatacacaaaaacacacacacatatataaacaatcccagctcagcattgataa |
45682032 |
T |
|
| Q |
215 |
gacaaattaattataatatactgtacagcatatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45682031 |
gacaaattaattataatatactgtacagcatatt |
45681998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3060 times since January 2019
Visitors: 3831