View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_57 (Length: 237)
Name: NF0601_low_57
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 16479814 - 16479599
Alignment:
Q |
8 |
aaattaaagcaatttatcgaaataaaaaattcataatctctcgacgatgaaattagtttattaattttctgtagacttatgttatggaagtagatatttc |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
16479814 |
aaattaaagcaatttatcgaaataaaaaattcaaaatctctcgacgatgaaattagtttattaattttctgtagacttgtgttatggaagtagatatttc |
16479715 |
T |
 |
Q |
108 |
aattgttatatatatttttgacagcaattgttatatttatttatctcaaagtatgtgtcatccgacgcagtataagccaccggctaaattaatctattat |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
16479714 |
aattgttatatatatttttgacagcaattgttata-ttatttatctcaaagtatgtgtcatccgacccagtataagccaccggctaaattaatctattat |
16479616 |
T |
 |
Q |
208 |
ttttgtttaactcttct |
224 |
Q |
|
|
|||| |||||||||||| |
|
|
T |
16479615 |
ttttctttaactcttct |
16479599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University