View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_58 (Length: 235)
Name: NF0601_low_58
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 8534528 - 8534454
Alignment:
Q |
1 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgct |
75 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8534528 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgct |
8534454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 8599767 - 8599693
Alignment:
Q |
1 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgct |
75 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8599767 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgct |
8599693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 8613659 - 8613733
Alignment:
Q |
1 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgct |
75 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8613659 |
aaagaacaagagacaagagaaactttcatatgtactgttccgatgtttcatatatacggtcttgcggtgtttgct |
8613733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University