View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0601_low_60 (Length: 208)
Name: NF0601_low_60
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0601_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 16193899 - 16193773
Alignment:
Q |
1 |
catacatggaaaataaagatagctcaattaagagtagaaggaatcaatgcttctatgtctttggttctctctctaaaatgtacaagaagacaaattatta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
16193899 |
catacatggaaaataaagatagctcaattaagagtagaaggaatcaatgcttctatgtttttggttctctctctaaaatgtataagaagacaaattatta |
16193800 |
T |
 |
Q |
101 |
gtggtgagaagagatgatgactagtat |
127 |
Q |
|
|
|||||||||||||||||||||| |||| |
|
|
T |
16193799 |
gtggtgagaagagatgatgactggtat |
16193773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University