View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602-INSERTION-17 (Length: 110)
Name: NF0602-INSERTION-17
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602-INSERTION-17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 28542652 - 28542550
Alignment:
| Q |
8 |
taaggtgttcttaggtagggtagtgatggattctcgtgacttttggattttcacacaacacgcttcgccgcgtcacaagccactattattttcatttttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28542652 |
taaggtgttcttaggtagggtagtgatggattctcgtgacttttggattttcacacaacacgcttcgccgcgtcacaagccactattagtttcatttttg |
28542553 |
T |
|
| Q |
108 |
cta |
110 |
Q |
| |
|
||| |
|
|
| T |
28542552 |
cta |
28542550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2460 times since January 2019
Visitors: 3819