View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_high_13 (Length: 318)
Name: NF0602_high_13
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0602_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 10 - 289
Target Start/End: Complemental strand, 24910379 - 24910100
Alignment:
Q |
10 |
gcatagggacgtatcagatgtgtatcgatatcagatacatgttacacaatgatgcttttctgtttttcaagtatcaacgcttcataggttgcatgtttta |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
24910379 |
gcatagggacgtatcagatgtgtatcgatatcagatacatgttacacaatgatgcttttctgtttttcaagtatcagcgcttcataggttgcatgtttta |
24910280 |
T |
 |
Q |
110 |
tttggggaattgggaccgggtaagggttgcaacttaatcttggttttggagcttaggaaatttaatgtagtactatgttgcaggtagtgttaagttgaaa |
209 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24910279 |
tttggggaattgggacggggtaagggttgcaacttaatcttggttttggagcttaggaaatttaatgtagtactatgttgcaggtagtgttaagttgaaa |
24910180 |
T |
 |
Q |
210 |
gaaactaagctttaggaatatgttatggcttcatttagtagtacaattataggtatagttgttctctttttgattctttc |
289 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24910179 |
gaaactaagctttaggaagatgttatggcttcatttagtagtacaattataggtatagttgttctctttttgattctttc |
24910100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 131 - 289
Target Start/End: Complemental strand, 24895926 - 24895768
Alignment:
Q |
131 |
aagggttgcaacttaatcttggttttggagcttaggaaatttaatgtagtactatgttgcaggtagtgttaagttgaaagaaactaagctttaggaatat |
230 |
Q |
|
|
||||||| || |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
24895926 |
aagggttacagcttagtcttgattttggagcttaggaaatttaatgtagtactatgttgcaggtagtgttaagttgaaagaaactaagctttaggaagat |
24895827 |
T |
 |
Q |
231 |
gttatggcttcatttagtagtacaattataggtatagttgttctctttttgattctttc |
289 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
24895826 |
gttatggcttcatttagtagtacaattataggtatagttgtcctctttttgattctttc |
24895768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 122
Target Start/End: Complemental strand, 24896002 - 24895952
Alignment:
Q |
72 |
tttttcaagtatcaacgcttcataggttgcatgttttatttggggaattgg |
122 |
Q |
|
|
||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
24896002 |
ttttttaagtatctgcgcttcataggttgaatgttttatttggggaattgg |
24895952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University